Sample runs for HW4:

------
$ java proj4
Input a DNA string: 
Input must be A, G, C, or T:
CATA
Input a DNA string: 
Input must be A, G, C, or T:
ATAC
The Hamming Distance is:  4
Input the substitution weights:
A->C: 3
A->G: 1
A->T: 3
C->G: 3
C->T: 1
G->T: 3
The Weighted Distance is:  12

Opt_Score Table:
   0   5  10  15  20
   5   3   6  11  15
  10   5   6   6  11
  15  10   5   9   7
  20  15  10   5  10
The Minimum Distance is:  10
Input a DNA string: 
Input must be A, G, C, or T:
ACGT
Input a DNA string: 
Input must be A, G, C, or T:
ACCGGGT

Opt_Score Table:
   0   5  10  15  20  25  30  35
   5   0   5  10  15  20  25  30
  10   5   0   5  10  15  20  25
  15  10   5   3   5  10  15  20
  20  15  10   6   6   8  13  15
The Minimum Distance is:  15

------
$ java proj4
Input a DNA string: 
Input must be A, G, C, or T:
ACE
Error:  Invalid character.
Input a DNA string: 
Input must be A, G, C, or T:
3
Error:  Invalid character.
Input a DNA string: 
Input must be A, G, C, or T:
ACGT
Input a DNA string: 
Input must be A, G, C, or T:
31
Error:  Invalid character.
Error:  Invalid character.
Input a DNA string: 
Input must be A, G, C, or T:
ACGGT
Error: GetHammingDist called with differing length DNA sequences.
Error in Hamming Distance computation
Input the substitution weights:
A->C: 3
A->G: 1
A->T: 3
C->G: 3
C->T: 1
G->T: 3
Error: GetWeightedDist called with differing length DNA sequences.
Error in Hamming Distance computation

Opt_Score Table:
   0   5  10  15  20  25
   5   0   5  10  15  20
  10   5   0   5  10  15
  15  10   5   0   5  10
  20  15  10   5   3   5
The Minimum Distance is:  5
Input a DNA string: 
Input must be A, G, C, or T:
ACTTGTGA
Input a DNA string: 
Input must be A, G, C, or T:
ACTTGTGAC

Opt_Score Table:
   0   5  10  15  20  25  30  35  40  45
   5   0   5  10  15  20  25  30  35  40
  10   5   0   5  10  15  20  25  30  35
  15  10   5   0   5  10  15  20  25  30
  20  15  10   5   0   5  10  15  20  25
  25  20  15  10   5   0   5  10  15  20
  30  25  20  15  10   5   0   5  10  15
  35  30  25  20  15  10   5   0   5  10
  40  35  30  25  20  15  10   5   0   5
The Minimum Distance is:  5

------
In the above sample output you see:
- same length sequences which require a gap for minimum alignment
- differing length sequences which require internal gaps for minimum alignment
- differing length sequences which need no internal gaps for minimum alignment
- invalid character input for DNA sequence
- numeric input for DNA sequence (also invalid)
- invalid data input several times in a row
- invalid data input for first as well as second DNA sequence
- differing length sequences entered for Hamming and weighted distance


Examples of other pairs of inputs which make good tests:

T		1 character, identical
T

T		1 character, weighted distance same as Hamming distance
C

T		1 character, weighted distance differs from Hamming distance
A

ACGT		identical
ACGT

ACGT		differs in every position
GTAC

ACGT		differs only in last position
ACGA

ACGT		differs only in first position
GCGT

TATATATATATATATATATA	long
TATATACATATATATATATA